pcDNA3.1_hCAR.Variant3
(Plasmid #209133)

• Purpose: The ORF of human constitutive androstane receptor (CAR), variant 3 cDNA amplified from the RT human liver RNA was cloned at the NheI/HindIII sites of the pcDNA3.1(+), the mammalian expression vector.
• Depositing Labs: Catharine Ross, Reza Zolfaghari
• Publication: Zolfaghari and Ross plasmids (unpublished)

Backbone

• Vector backbone: pcDNA3.1 (+)
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5428
• Total vector size (bp): 6475
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: constitutive androstane receptor (CAR), Variant 3
• Alt name: CAR
• Species: H. sapiens (human)
• Insert Size (bp): 1047
• GenBank ID: NM_005122
• Entrez Gene: NR1I3 (a.k.a. CAR, CAR1, MB67)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: atgctagcgccaccatggccagtagggaagatg
• 3′ sequencing primer: ttaagcttcagctgcagatctcctgg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry