Skip to main content
Addgene

MD~E-pCLBabe
(Plasmid #20912)

Print

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 20912 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBabe
  • Backbone size w/o insert (bp) 4500
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MyoD~E12 forced dimer
  • Alt name
    E2A (E12 isoform)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3000
  • Mutation
    Short flexible linker region between the MyoD and E12 sequences.
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GATCCTCCCTTTATCCAGCCCTC
  • 3′ sequencing primer GGACTTTCCACACCCTAACTGACAC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MD~E-pCLBabe was a gift from Stephen Tapscott (Addgene plasmid # 20912 ; http://n2t.net/addgene:20912 ; RRID:Addgene_20912)

  • For your References section:

    MyoD and E-protein heterodimers switch rhabdomyosarcoma cells from an arrested myoblast phase to a differentiated state. Yang Z, MacQuarrie KL, Analau E, Tyler AE, Dilworth FJ, Cao Y, Diede SJ, Tapscott SJ. Genes Dev. 2009 Mar 15. 23(6):694-707. 10.1101/gad.1765109 PubMed 19299559
Related items:
Commonly requested with: