pLKO.1-shCdh10.1 GFP
(Plasmid
#209101)
-
PurposeGFP expressing shRNA targeting Cdh10
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209101 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO.1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshCdh10.1
-
gRNA/shRNA sequenceATGAGAACCGAAGACTATATA
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-shCdh10.1 GFP was a gift from Cagla Eroglu (Addgene plasmid # 209101 ; http://n2t.net/addgene:209101 ; RRID:Addgene_209101) -
For your References section:
delta-Catenin controls astrocyte morphogenesis via layer-specific astrocyte-neuron cadherin interactions. Tan CX, Bindu DS, Hardin EJ, Sakers K, Baumert R, Ramirez JJ, Savage JT, Eroglu C. J Cell Biol. 2023 Nov 6;222(11):e202303138. doi: 10.1083/jcb.202303138. Epub 2023 Sep 14. 10.1083/jcb.202303138 PubMed 37707499