Skip to main content
Addgene

pENTR223-CMV-Cre-U6-sgNotch1#1-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
(Plasmid #209068)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209068 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDONR223
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5005
  • Total vector size (bp) 6119
  • Vector type
    Gateway vector to be used for LR reaction

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNAs targeting Notch1, Rb1, Trp53, Rbl2 and Cre recombinase
  • gRNA/shRNA sequence
    CACCGCGAGCGCGGGCAGCAGCGTT
  • Species
    M. musculus (mouse)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3i (unknown if destroyed)
  • 3′ cloning site Esp3i (unknown if destroyed)
  • 5′ sequencing primer M13F
  • 3′ sequencing primer M13R
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR223-CMV-Cre-U6-sgNotch1#1-U6-sgRb1-U6-sgTrp53-U6-sgRbl2 was a gift from Matthew Oser (Addgene plasmid # 209068 ; http://n2t.net/addgene:209068 ; RRID:Addgene_209068)
  • For your References section:

    Plasticity in the Absence of NOTCH Uncovers a RUNX2-Dependent Pathway in Small Cell Lung Cancer. Hong D, Knelson EH, Li Y, Durmaz YT, Gao W, Walton E, Vajdi A, Thai T, Sticco-Ivins M, Sabet AH, Jones KL, Schinzel AC, Bronson RT, Nguyen QD, Tolstorukov MY, Vivero M, Signoretti S, Barbie DA, Oser MG. Cancer Res. 2022 Jan 15;82(2):248-263. doi: 10.1158/0008-5472.CAN-21-1991. Epub 2021 Nov 22. 10.1158/0008-5472.CAN-21-1991 PubMed 34810201