pCHA_OROV_NSm
(Plasmid
#208940)
-
PurposeExpresses C-terminally HA-tagged Oropouche orthobunyavirus NSm protein from CMV promoter in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208940 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
This item is currently unavailable outside the US without additional regulatory approval.
A non-refundable shipping export licensing fee of $85 is required to cover Addgene’s additional processing costs.
Backbone
-
Vector backboneV27 pLPS-3' HA - Acceptor
-
Backbone manufacturerTony Pawson
- Backbone size w/o insert (bp) 4195
- Total vector size (bp) 4723
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNSm
-
Alt nameMedium non-structural protein
-
SpeciesOropouche orthobunyavirus
-
Insert Size (bp)528
-
MutationDeleted 949 bp from 5' end (Gn), deleted 2911 bp from 3' end (Gc) and inserted start codon at 5' end so only NSm expressed
-
GenBank IDNC_005775.1
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOROV genes were cloned from plasmids provided by Prof. Richard Elliott, University of Glasgow.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCHA_OROV_NSm was a gift from Gerald Barry (Addgene plasmid # 208940 ; http://n2t.net/addgene:208940 ; RRID:Addgene_208940)