Skip to main content
Addgene

pCHA_SBV_NSs
(Plasmid #208938)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208938 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    V27 pLPS-3' HA - Acceptor
  • Backbone manufacturer
    Tony Pawson
  • Backbone size w/o insert (bp) 4195
  • Total vector size (bp) 4468
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NSs
  • Alt name
    Small non-structural protein
  • Species
    Schmallenberg orthobunyavirus
  • Insert Size (bp)
    273
  • Mutation
    Deleted 47 bp at 5' end and 510 bp from 3' end (including stop codon) so only expresses NSs
  • GenBank ID
    HE649914.1
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    SBV genes were cloned from plasmids provided by Prof. Massimo Palmarini, University of Glasgow.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCHA_SBV_NSs was a gift from Gerald Barry (Addgene plasmid # 208938 ; http://n2t.net/addgene:208938 ; RRID:Addgene_208938)