pNHA_OROV_NCP
(Plasmid
#208937)
-
PurposeExpresses N-terminally HA-tagged Oropouche orthobunyavirus nucleocapsid protein from CMV promoter in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208937 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
This item is currently unavailable outside the US without additional regulatory approval.
A non-refundable shipping export licensing fee of $85 is required to cover Addgene’s additional processing costs.
Backbone
-
Vector backbonepCMV-HA
-
Backbone manufacturerChristopher A Walsh
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 4493
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNucleocapsid
-
Alt nameN, NCP
-
SpeciesOropouche orthobunyavirus
-
Insert Size (bp)693
-
MutationDeleted start codon so HA included at N-terminus
-
GenBank IDNC_005777.1
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAGGAAACAGCTATGAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOROV genes were cloned from plasmids provided by Prof. Richard Elliott, University of Glasgow.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNHA_OROV_NCP was a gift from Gerald Barry (Addgene plasmid # 208937 ; http://n2t.net/addgene:208937 ; RRID:Addgene_208937)