Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pNHA_OROV_NCP
(Plasmid #208937)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 208937 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

This item is currently unavailable outside the US without additional regulatory approval.
A non-refundable shipping export licensing fee of $85 is required to cover Addgene’s additional processing costs.

Backbone

  • Vector backbone
    pCMV-HA
  • Backbone manufacturer
    Christopher A Walsh
  • Backbone size w/o insert (bp) 3800
  • Total vector size (bp) 4493
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nucleocapsid
  • Alt name
    N, NCP
  • Species
    Oropouche orthobunyavirus
  • Insert Size (bp)
    693
  • Mutation
    Deleted start codon so HA included at N-terminus
  • GenBank ID
    NC_005777.1
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    OROV genes were cloned from plasmids provided by Prof. Richard Elliott, University of Glasgow.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNHA_OROV_NCP was a gift from Gerald Barry (Addgene plasmid # 208937 ; http://n2t.net/addgene:208937 ; RRID:Addgene_208937)