pNHA_SBV_Gc
(Plasmid #208933)

• Purpose: Expresses N-terminally HA-tagged Schmallenberg orthobunyavirus Gc protein from CMV promoter in mammalian cells
• Depositing Lab: Gerald Barry
• Publication: Plasmids encoding N- and C-terminally HA tagged Oropouche and Schmallenberg orthobunyavirus proteins (unpublished)

Backbone

• Vector backbone: pCMV-HA
• Backbone manufacturer: Christopher A Walsh
• Backbone size w/o insert (bp): 3800
• Total vector size (bp): 6155
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Gc
• Alt name: G1, glycoprotein, envelope protein
• Insert Size (bp): 2358
• Mutation: Deleted 1682 bp from 5' end, deleted 378 bp from 3' end and inserted stop codon so Gc expressed
• GenBank ID: HE649913.1
• Promoter: CMV
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CAGGAAACAGCTATGAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: SBV genes were cloned from plasmids provided by Prof. Massimo Palmarini, University of Glasgow.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry