Skip to main content
Addgene

AAV-U6-sgLacZ-U6-sgGFP-hSyn1-mCherry
(Plasmid #208834)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208834 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Hewitt Lab
  • Modifications to backbone
    pX552 (Addgene #60958) was modified with additional of sgRNAs targeting LacZ and GFP with a replacement of GFP-KASH with mCherry coding sequence from Addgene #87916
  • Vector type
    Mammalian Expression, Bacterial Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • gRNA/shRNA sequence
    sgLacZ / sgGFP
  • Species
    Discosoma
  • Promoter hSyn1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer CCCCGTAATGCAGAAGAAGA
  • 3′ sequencing primer TTGGTCACCTTCAGCTTGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pX552 (Addgene #60958) was modified with additional of sgRNAs targeting LacZ and GFP with a replacement of GFP-KASH with mCherry coding sequence from Addgene #87916

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-U6-sgLacZ-U6-sgGFP-hSyn1-mCherry was a gift from Ben Emery (Addgene plasmid # 208834 ; http://n2t.net/addgene:208834 ; RRID:Addgene_208834)

  • For your References section:

    Remyelination protects neurons from DLK-mediated neurodegeneration. Duncan GJ, Ingram SD, Emberley K, Hill J, Cordano C, Abdelhak A, McCane M, Jenks JE, Jabassini N, Ananth K, Ferrara SJ, Stedelin B, Sivyer B, Aicher SA, Scanlan TS, Watkins TA, Mishra A, Nelson JW, Green AJ, Emery B. Nat Commun. 2024 Oct 23;15(1):9148. doi: 10.1038/s41467-024-53429-5. 10.1038/s41467-024-53429-5 PubMed 39443516
Related items: