Skip to main content
Addgene

pCAROTENE5X
(Plasmid #208816)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208816 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Synthetic backbone
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Five copies of JUB1 binding site within the synthetic promoter
  • Species
    A. thaliana (mustard weed), Synthetic
  • Promoter JUB1 TF-responsive promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTTTCGTCTTCACCTCGAG
  • 3′ sequencing primer gtaatccgtcatggctgaca
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A R185H mutation in crtB was found.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAROTENE5X was a gift from Marc Erhardt (Addgene plasmid # 208816 ; http://n2t.net/addgene:208816 ; RRID:Addgene_208816)
  • For your References section:

    A versatile regulatory toolkit of arabinose-inducible artificial transcription factors for Enterobacteriaceae. Naseri G, Raasch H, Charpentier E, Erhardt M. Commun Biol. 2023 Oct 3;6(1):1005. doi: 10.1038/s42003-023-05363-3. 10.1038/s42003-023-05363-3 PubMed 37789111