pGL-p21UTRm1&2
(Plasmid
#20880)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 20880 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL3-Control
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5256
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep21 3'UTR site 1 and 2 mutation
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1300
-
MutationPredicted miRNA binding site 1 (Position ~420) GCACTTT to GCAATGT Predicted miRNA binding site 2 (Position ~1100) GCACTTA to GCCCGTA
-
GenBank IDNM_007669
-
Entrez GeneCdkn1a (a.k.a. CAP20, CDKI, CIP1, Cdkn1, P21, SDI1, Waf1, mda6, p21Cip1, p21WAF)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GGAAAACTCGACGCAAGA
- 3′ sequencing primer CACATTTGTAGAGGTTTTACTTGCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL-p21UTRm1&2 was a gift from Robert Blelloch (Addgene plasmid # 20880 ; http://n2t.net/addgene:20880 ; RRID:Addgene_20880) -
For your References section:
Embryonic stem cell-specific microRNAs regulate the G1-S transition and promote rapid proliferation. Wang Y, Baskerville S, Shenoy A, Babiarz JE, Baehner L, Blelloch R. Nat Genet. 2008 Dec . 40(12):1478-83. 10.1038/ng.250 PubMed 18978791
Map uploaded by the depositor.