Skip to main content
Addgene

pET28a-DONSON
(Plasmid #208797)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208797 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET28a
  • Backbone size w/o insert (bp) 5369
  • Total vector size (bp) 7054
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Expression overnight at 18°C
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DONSON
  • Alt name
    Protein downstream neighbor of son homolog
  • Species
    X. laevis (frog)
  • Insert Size (bp)
    1791
  • GenBank ID
    NM_001095087.1 NP_001088556.1
  • Entrez Gene
    donson.L (a.k.a. XELAEV_18011478mg, donson)
  • Promoter T7
  • Tags / Fusion Proteins
    • His (N terminal on insert)
    • Myc (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-DONSON was a gift from Aga Gambus (Addgene plasmid # 208797 ; http://n2t.net/addgene:208797 ; RRID:Addgene_208797)

  • For your References section:

    The structural mechanism of dimeric DONSON in replicative helicase activation. Cvetkovic MA, Passaretti P, Butryn A, Reynolds-Winczura A, Kingsley G, Skagia A, Fernandez-Cuesta C, Poovathumkadavil D, George R, Chauhan AS, Jhujh SS, Stewart GS, Gambus A, Costa A. Mol Cell. 2023 Nov 16;83(22):4017-4031.e9. doi: 10.1016/j.molcel.2023.09.029. Epub 2023 Oct 10. 10.1016/j.molcel.2023.09.029 PubMed 37820732
Related items: