pET28a-DONSON
(Plasmid
#208797)
-
PurposeXenopus laevis His6-Myc-DONSON wild type
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208797 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28a
- Backbone size w/o insert (bp) 5369
- Total vector size (bp) 7054
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsExpression overnight at 18°C
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDONSON
-
Alt nameProtein downstream neighbor of son homolog
-
SpeciesX. laevis (frog)
-
Insert Size (bp)1791
-
GenBank IDNM_001095087.1 NP_001088556.1
-
Entrez Genedonson.L (a.k.a. XELAEV_18011478mg, donson)
- Promoter T7
-
Tags
/ Fusion Proteins
- His (N terminal on insert)
- Myc (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-DONSON was a gift from Aga Gambus (Addgene plasmid # 208797 ; http://n2t.net/addgene:208797 ; RRID:Addgene_208797) -
For your References section:
The structural mechanism of dimeric DONSON in replicative helicase activation. Cvetkovic MA, Passaretti P, Butryn A, Reynolds-Winczura A, Kingsley G, Skagia A, Fernandez-Cuesta C, Poovathumkadavil D, George R, Chauhan AS, Jhujh SS, Stewart GS, Gambus A, Costa A. Mol Cell. 2023 Nov 16;83(22):4017-4031.e9. doi: 10.1016/j.molcel.2023.09.029. Epub 2023 Oct 10. 10.1016/j.molcel.2023.09.029 PubMed 37820732