pAAV-C2-SNAP
(Plasmid #208794)

• Purpose: For AAV production to express C2-SNAP in astrocytes
• Depositing Lab: Urte Neniskyte
• Publication: Dirvelyte et al Cell Mol Biol Lett. 2023 Jul 27;28(1):59. doi: 10.1186/s11658-023-00472-7.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-GFAP-mKate2.5f
• Backbone manufacturer: Viviana Gradinaru
• Backbone size w/o insert (bp): 4496
• Total vector size (bp): 5699
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: C2-SNAP
• Alt name: C2 domain
• Species: M. musculus (mouse)
• Insert Size (bp): 1203
• GenBank ID: 17304
• Entrez Gene: Mfge8 (a.k.a. MFG-E8, MP47, Mfgm, P47, SED1, lactadherin)
• Promoter: GFAP promoter
• Tag / Fusion Protein:
  • SNAP-tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AflII (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GAAGGTCTGAAGAGTTTACTCC
• 3′ sequencing primer: AATGAAAGCCATACGGGAAG

Resource Information

• Supplemental Documents:
  • paav-c2-snap.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: The plasmid contains a 22bp deletion and three A/T mixed bases in the 5' ITR. The plasmid was successfully used for AAV packaging and expression in cells and tissues by the depositing lab. These discrepancies are not expected to affect plasmid function.