pAAV-C2m2-mKate
(Plasmid #208793)

• Purpose: For AAV production to express C2m2-mKate in astrocytes
• Depositing Lab: Urte Neniskyte
• Publication: Dirvelyte et al Cell Mol Biol Lett. 2023 Jul 27;28(1):59. doi: 10.1186/s11658-023-00472-7.

Backbone

• Vector backbone: pAAV-GFAP-mKate2.5f
• Backbone manufacturer: Viviana Gradinaru
• Backbone size w/o insert (bp): 4496
• Total vector size (bp): 5852
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: C2m2-mKate
• Alt name: C2 domain
• Species: M. musculus (mouse)
• Insert Size (bp): 1356
• Mutation: Mutated 24 and 45 lysine to asparagine in C2 domain (K24N, K45N), disabling the probe binding to phosphatidylserine
• GenBank ID: 17304
• Entrez Gene: Mfge8 (a.k.a. MFG-E8, MP47, Mfgm, P47, SED1, lactadherin)
• Promoter: GFAP promoter
• Tag / Fusion Protein:
  • mKate (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AflII (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GAAGGTCTGAAGAGTTTACTCC
• 3′ sequencing primer: AATGAAAGCCATACGGGAAG

Resource Information

• Supplemental Documents:
  • paav-c2m2-mkate.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: The plasmid contains a 22bp deletion in the 5' ITR. The plasmid was successfully used for AAV packaging and expression in cells and tissues by the depositing lab. These discrepancies are not expected to affect plasmid function.