phROSA26-Tet-HA-JSAP1_WT
(Plasmid #208772)

• Purpose: Tetracycline inducible expression vector for HA-JSAP1_WT, used as a donor plasmid for HA-JSAP1_WT knock-in at the human ROSA26 locus
• Depositing Lab: Katsuji Yoshioka
• Publication: Suzuki et al Genes Cells. 2023 Nov 14. doi: 10.1111/gtc.13083.

Backbone

• Vector backbone: pMK365
• Backbone manufacturer: Addgene #121185
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: JSAP1
• Alt name: JIP3
• Alt name: MAP8IP3
• Species: H. sapiens (human)
• Insert Size (bp): 4023
• Entrez Gene: MAPK8IP3 (a.k.a. JIP-3, JIP3, JSAP1, NEDBA, SYD2, syd)
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CTTTGCTTATGTAAACCAGG
• 3′ sequencing primer: attaagggttattgaatatgatcgCCCCGAAAAGTGCCACCTGACGTCG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry