Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

phROSA26-Tet-HA-JLP_V55Q
(Plasmid #208771)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 208771 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMK365
  • Backbone manufacturer
    Addgene #121185
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    JLP
  • Alt name
    JIP4
  • Alt name
    SPAG9
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3996
  • Entrez Gene
    SPAG9 (a.k.a. CT89, HLC-6, HLC4, HLC6, JIP-4, JIP4, JLP, PHET, PIG6)
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CTTTGCTTATGTAAACCAGG
  • 3′ sequencing primer attaagggttattgaatatgatcgCCCCGAAAAGTGCCACCTGACGTCG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    phROSA26-Tet-HA-JLP_V55Q was a gift from Katsuji Yoshioka (Addgene plasmid # 208771 ; http://n2t.net/addgene:208771 ; RRID:Addgene_208771)
  • For your References section:

    Overexpression of JNK-associated leucine zipper protein induces chromosomal instability through interaction with dynein light intermediate chain 1. Suzuki R, Kanemaki MT, Suzuki T, Yoshioka K. Genes Cells. 2023 Nov 14. doi: 10.1111/gtc.13083. 10.1111/gtc.13083 PubMed 37963657