pETDuet1_CoiC_CoiSA
(Plasmid #208762)

• Purpose: Two coi synthase CoiC and CoiSA, for the co-expression of CoiA1 in E.coli.
• Depositing Lab: Wilfred van der Donk
• Publication: Luo et al Anal Chem. 2024 Jan 30;96(4):1767-1773. doi: 10.1021/acs.analchem.3c04958. Epub 2024 Jan 17.

Backbone

• Vector backbone: pETDuet1
• Total vector size (bp): 8631
• Modifications to backbone: triplet deletion (TAT) between A6187 and A6188 at the bom gene
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: CoiC
• Alt name: cyclase CoiC
• Species: Synthetic
• Insert Size (bp): 1260
• Mutation: single nucleotide insertion (C70) at RBS of CoiC
• Promoter: T7

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cctctagaaataattttgtttaac
• 3′ sequencing primer: cgtgtacaatacgattactttc

Gene/Insert 2

• Gene/Insert name: CoiSA
• Alt name: glutamyl lyase CoiSA
• Species: Synthetic
• Insert Size (bp): 2091
• Promoter: T7

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cacggccgcataatcgaaat
• 3′ sequencing primer: ccgctgagcaataactagc

Resource Information

• Supplemental Documents:
  • pETDuet1_CoiC_CoiSA.gb
• Addgene Notes:
  • Addgene Diagnostic Digest

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2023.10.26.564210v2 for bioRxiv preprint.