pRSFDuet1_CoiA1_CoiB
(Plasmid #208761)

• Purpose: Precursor peptide CoiA1 and synthase CoiB, for the co-expression of CoiA1 in E.coli.
• Depositing Lab: Wilfred van der Donk
• Publication: Luo et al Anal Chem. 2024 Jan 30;96(4):1767-1773. doi: 10.1021/acs.analchem.3c04958. Epub 2024 Jan 17.

Backbone

• Vector backbone: pRSFDuet1
• Total vector size (bp): 7352
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: CoiA1
• Alt name: precursor lanthipeptide A1 on coi BGC
• Species: Synthetic
• Insert Size (bp): 549
• Mutation: Changed Ser 20 to Asn, Changed Arg 84 to Lys, both mutations on SUMO
• Promoter: T7
• Tags / Fusion Proteins:
  • Hisx6 Tag (N terminal on insert)
  • SUMO (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cggataacaattcccctgtag

Gene/Insert 2

• Gene/Insert name: CoiB
• Alt name: lanthipeptide dehydratase CoiB
• Species: Synthetic
• Insert Size (bp): 3099
• Promoter: T7

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cggccgcataatcgaaat
• 3′ sequencing primer: gctagttattgctcagcgg

Resource Information

• Supplemental Documents:
  • pRSFDuet1_CoiA1_CoiB.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2023.10.26.564210v2 for bioRxiv preprint.