pRSFDuet1_CylLL_CylM
(Plasmid
#208759)
-
PurposeExpresses modified cytolysin L (mCylLL) in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208759 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRSFDuet1
- Total vector size (bp) 6937
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCylLL
-
Alt nameCytolysin L
-
SpeciesSynthetic
-
Insert Size (bp)237
- Promoter T7
-
Tag
/ Fusion Protein
- Hisx6 Tag (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer cttatgcgactcctgcattaggaa (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCylLM
-
Alt nameLanthionine synthetase CylLM
-
SpeciesSynthetic
-
Insert Size (bp)2911
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer ttgtacacggccgcataatc
- 3′ sequencing primer gctagttattgctcagcgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.10.26.564210v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSFDuet1_CylLL_CylM was a gift from Wilfred van der Donk (Addgene plasmid # 208759 ; http://n2t.net/addgene:208759 ; RRID:Addgene_208759) -
For your References section:
Facile Method for Determining Lanthipeptide Stereochemistry. Luo Y, Xu S, Frerk AM, van der Donk WA. Anal Chem. 2024 Jan 30;96(4):1767-1773. doi: 10.1021/acs.analchem.3c04958. Epub 2024 Jan 17. 10.1021/acs.analchem.3c04958 PubMed 38232355