-
PurposeExpresses the genetically-encoded fluorescent norepinephrine (NE) sensor GRAB_NE2h in neurons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208687 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4495
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGPCR activation based norepinephrine (NE) sensor GRAB_NE2h
-
Alt nameGRAB_NE2h
-
Alt nameNE2h
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1992
- Promoter hSyn
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACGGGCGCGACCATCTGCGC
- 3′ sequencing primer CATTAAAGCAGCGTATCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.06.22.546075v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hsyn-NE2h was a gift from Yulong Li (Addgene plasmid # 208687 ; http://n2t.net/addgene:208687 ; RRID:Addgene_208687)