Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-hSyn-DIO-GRAB_UCN1.0
(Plasmid #208669)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208669 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4552
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GPCR activation based urocortin (UCN) sensor GRAB_UCN1.0
  • Alt name
    GRAB_UCN1.0
  • Alt name
    UCN1.0
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2106
  • Promoter hSyn

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACGGGCGCGACCATCTGCGC
  • 3′ sequencing primer CATTAAAGCAGCGTATCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-DIO-GRAB_UCN1.0 was a gift from Yulong Li (Addgene plasmid # 208669 ; http://n2t.net/addgene:208669 ; RRID:Addgene_208669)
  • For your References section:

    A tool kit of highly selective and sensitive genetically encoded neuropeptide sensors. Wang H, Qian T, Zhao Y, Zhuo Y, Wu C, Osakada T, Chen P, Chen Z, Ren H, Yan Y, Geng L, Fu S, Mei L, Li G, Wu L, Jiang Y, Qian W, Zhang L, Peng W, Xu M, Hu J, Jiang M, Chen L, Tang C, Zhu Y, Lin D, Zhou JN, Li Y. Science. 2023 Nov 17;382(6672):eabq8173. doi: 10.1126/science.abq8173. Epub 2023 Nov 17. 10.1126/science.abq8173 PubMed 37972184