pAAV-hSyn-DIO-GRAB_CRF0.5
(Plasmid
#208660)
-
PurposeExpresses the genetically-encoded fluorescent corticotropin-releasing factor (CRF) sensor GRAB_CRF0.5 in a cre-dependent manner
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208660 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4552
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGPCR activation based corticotropin-releasing factor (CRF) sensor GRAB_CRF0.5
-
Alt nameGRAB_CRF0.5
-
Alt nameCRF0.5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2124
- Promoter hSyn
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACGGGCGCGACCATCTGCGC
- 3′ sequencing primer CATTAAAGCAGCGTATCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.03.26.485911v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-DIO-GRAB_CRF0.5 was a gift from Yulong Li (Addgene plasmid # 208660 ; http://n2t.net/addgene:208660 ; RRID:Addgene_208660) -
For your References section:
A tool kit of highly selective and sensitive genetically encoded neuropeptide sensors. Wang H, Qian T, Zhao Y, Zhuo Y, Wu C, Osakada T, Chen P, Chen Z, Ren H, Yan Y, Geng L, Fu S, Mei L, Li G, Wu L, Jiang Y, Qian W, Zhang L, Peng W, Xu M, Hu J, Jiang M, Chen L, Tang C, Zhu Y, Lin D, Zhou JN, Li Y. Science. 2023 Nov 17;382(6672):eabq8173. doi: 10.1126/science.abq8173. Epub 2023 Nov 17. 10.1126/science.abq8173 PubMed 37972184