-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 20864 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAcGP67A
-
Backbone manufacturerBD biosciences
- Backbone size w/o insert (bp) 9761
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMyeloid differentiation factor 2
-
Alt nameMD-2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)861
-
Mutationcontains amino acids 19–160
-
GenBank IDNP_056179.3
-
Entrez GeneLY96 (a.k.a. ESOP-1, MD-2, MD2, ly-96)
-
Tag
/ Fusion Protein
- protein A tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ggcttcaataaggaacacacaagcaag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MD-2 was a gift from Jie-Oh Lee (Addgene plasmid # 20864 ; http://n2t.net/addgene:20864 ; RRID:Addgene_20864) -
For your References section:
The structural basis of lipopolysaccharide recognition by the TLR4-MD-2 complex. Park BS, Song DH, Kim HM, Choi BS, Lee H, Lee JO. Nature. 2009 Mar 1. ():. 10.1038/nature07830 PubMed 19252480