CRY2clust-mCherry-RANK-P2A-CIBNcaax
(Plasmid #208613)

• Purpose: Mammalian expression of CRY2clust-mCherry-RANK-P2A-CIBNcaax (Opto-RANKm)
• Depositing Labs: Tomohiro Ishii, Takao Nakata
• Publication: Takada et al Sci Rep. 2024 Jan 19;14(1):1749. doi: 10.1038/s41598-024-52056-w.

Backbone

• Vector backbone: pCAG-WPRE/N1 (modified pEGFP-N1)
• Backbone manufacturer: Modified from Clontech
• Backbone size w/o insert (bp): 5731
• Total vector size (bp): 10486
• Modifications to backbone: CMV promoter was replaced by CAG promoter, the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) was inserted, and EGFP was removed.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CRY2clust-mCherry-RANK-P2A-CIBNcaax
• Alt name: Opto-RANKm
• Species: M. musculus (mouse), A. thaliana (mustard weed)
• Insert Size (bp): 4755
• Entrez Gene: Cry2 (a.k.a. D130054K12Rik)
• Promoter: CAG
• Tags / Fusion Proteins:
  • mCherry
  • CAAX (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: GCAACGTGCTGGTTATTGTG
• 3′ sequencing primer: GCGTAAAAGGAGCAACATAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Dr. Won Do Heo (CRY2clust from mCherry-CRY2clust, Addgene ID 105624 ): One silent mutation at a KpnI site is introduced. Dr. Kai Zhang (P2A-CIBN-CIBN from OptoRaf, Addgene ID 207163): One silent mutation at an XhoI site is introduced.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry