T7-RBS-6xHis-SUMO-dSynCas.v10 bacteria
(Plasmid
#208595)
-
PurposeProduction and purification of catalytically inactive SynCas.v10
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208595 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET
- Backbone size w/o insert (bp) 5253
- Total vector size (bp) 9456
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedSynCas.v10
-
SpeciesSynthetic
-
Insert Size (bp)4203
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtgagcggataacaattccc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
T7-RBS-6xHis-SUMO-dSynCas.v10 bacteria was a gift from Omar Akbari (Addgene plasmid # 208595 ; http://n2t.net/addgene:208595 ; RRID:Addgene_208595) -
For your References section:
Parasitic nematode fatty acid- and retinol-binding proteins compromise host immunity by interfering with host lipid signaling pathways. Parks SC, Nguyen S, Nasrolahi S, Bhat C, Juncaj D, Lu D, Ramaswamy R, Dhillon H, Fujiwara H, Buchman A, Akbari OS, Yamanaka N, Boulanger MJ, Dillman AR. PLoS Pathog. 2021 Oct 29;17(10):e1010027. doi: 10.1371/journal.ppat.1010027. eCollection 2021 Oct. 10.1371/journal.ppat.1010027 PubMed 34714893