CMV-SynCas.v10 mammalian expression
(Plasmid
#208589)
-
PurposeExpression of SynCas.v10 for analysis of RNA knockdown
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208589 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC
- Backbone size w/o insert (bp) 3368
- Total vector size (bp) 7169
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSynCas.v10
-
SpeciesSynthetic
-
Insert Size (bp)3801
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctggtttagtgaaccgtcag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-SynCas.v10 mammalian expression was a gift from Omar Akbari (Addgene plasmid # 208589 ; http://n2t.net/addgene:208589 ; RRID:Addgene_208589) -
For your References section:
Parasitic nematode fatty acid- and retinol-binding proteins compromise host immunity by interfering with host lipid signaling pathways. Parks SC, Nguyen S, Nasrolahi S, Bhat C, Juncaj D, Lu D, Ramaswamy R, Dhillon H, Fujiwara H, Buchman A, Akbari OS, Yamanaka N, Boulanger MJ, Dillman AR. PLoS Pathog. 2021 Oct 29;17(10):e1010027. doi: 10.1371/journal.ppat.1010027. eCollection 2021 Oct. 10.1371/journal.ppat.1010027 PubMed 34714893