pUb FLAG-Mts H59Q
(Plasmid
#208402)
-
PurposeExpresses FLAG-tagged Drosophila mts protein with H59Q mutation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208402 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUb 3xFLAG MCS
- Total vector size (bp) 5753
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemicrotubule star
-
SpeciesD. melanogaster (fly)
-
MutationH59Q
-
Entrez Genemts (a.k.a. Dmel_CG7109, 5559, CG7109, DmPp2A-28D, Dmel\CG7109, ER2-6, MTS, MTS/PP2A, Mts, PP2, PP2A, PP2A 28D, PP2A C, PP2A-C, PP2A/MTS, PP2AC, PP2A[C], PP2A[[C]], PP2Ac, PP2a, PP2a 28D, Pp2A, Pp2A-28D, dPP2A, dPP2A-C, l(2)02496, l(2)s5286, pp2A)
- Promoter Ubi-p63e
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CAAAGTTGGCGTCGATAAATAAGTTTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUb FLAG-Mts H59Q was a gift from Jeremy Wilusz (Addgene plasmid # 208402 ; http://n2t.net/addgene:208402 ; RRID:Addgene_208402) -
For your References section:
IntS6 and the Integrator phosphatase module tune the efficiency of select premature transcription termination events. Fujiwara R, Zhai SN, Liang D, Shah AP, Tracey M, Ma XK, Fields CJ, Mendoza-Figueroa MS, Meline MC, Tatomer DC, Yang L, Wilusz JE. Mol Cell. 2023 Nov 14:S1097-2765(23)00902-4. doi: 10.1016/j.molcel.2023.10.035. 10.1016/j.molcel.2023.10.035 PubMed 37995689