Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti gRNA KO OCLNx2 spCas9-T2A-mNeonGreen-P2A-puro
(Plasmid #208400)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208400 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti spCas9 T2A mNeonGreen P2A puro
  • Backbone manufacturer
    Addgene #122183
  • Total vector size (bp) 14207
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin, Zeocin ; fluorescent mNeonGreen

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hU6-gRNA and hH1-gRNA targeting OCLN gene
  • gRNA/shRNA sequence
    GGCCTCTTGAAAGTCCACCT and TGTCATCCAGGCCTCTTGAA
  • Species
    H. sapiens (human)
  • GenBank ID
    100506658
  • Entrez Gene
    OCLN (a.k.a. BLCPMG, PPP1R115, PTORCH1)
  • Tag / Fusion Protein
    • mNeonGreen (C terminal on backbone)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti gRNA KO OCLNx2 spCas9-T2A-mNeonGreen-P2A-puro was a gift from Raphael Gaudin (Addgene plasmid # 208400 ; http://n2t.net/addgene:208400 ; RRID:Addgene_208400)
  • For your References section:

    LC3B conjugation machinery promotes autophagy-independent HIV-1 entry in CD4+ T lymphocytes. Baptiste Pradel , Maïka S. Deffieu, Véronique Robert-Hebmann, Guilhem Cantaloube, Mathias Faure, Nathalie Chazal, View ORCID ProfileRaphaël Gaudin, View ORCID ProfileLucile Espert. bioRxiv 10.1101/2023.07.11.548555