pAAV-CAG-mCherry-Tandem-PSAM4-GlyR
(Plasmid #208361)

• Purpose: Expression of the inhibitory chemogenetic tool PSAM4-GlyR and mCherry reporter. Application of ultrapotent agonists induces neuronal silencing.
• Depositing Lab: David Bennett
• Publication: Perez-Sanchez et al Sci Transl Med. 2023 Oct 4;15(716):eadh3839. doi: 10.1126/scitranslmed.adh3839. Epub 2023 Oct 4.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 5100
• Total vector size (bp): 7242
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry-TANDEM-PSAM4-GlyR
• Alt name: mCherry-P2A-T2A-PSAM4-GlyR
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 2142
• Promoter: CAG
• Tag / Fusion Protein:
  • mCherry

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: GCCTCTGCTAACCATGTTCATGCCTTCTTC
• 3′ sequencing primer: GGCTGATCAGCGGGTTTAAAC

Resource Information

• Supplemental Documents:
  • paav-cag-mcherry-tandem-psam4glyr-bghpolya.gb
• A portion of this plasmid was derived from a plasmid made by: Original construct for PSAM4-GlyR was a gift from Scott Sternson (Addgene plasmid #119739) Magnus et al Science. 2019. All other parts were generated using gene fragment synthesis.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The tandem linker sequence (Furin-GSG-P2A-GSG-T2A) was first used by Lui et al 2017, PMID: 28526819