pEGFP-ORP8-H514A-H515A
(Plasmid #208360)

• Purpose: Mammalian expression of fluorescent N-terminally tagged H514A-H515A mutant of ORP8
• Depositing Lab: Paula Nunes-Hasler
• Publication: Criado Santos et al Commun Biol. 2023 Oct 4;6(1):1008. doi: 10.1038/s42003-023-05382-0.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3975
• Total vector size (bp): 7251
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ORP8
• Alt name: OSBPL8
• Alt name: ORP8S
• Species: H. sapiens (human)
• Insert Size (bp): 3276
• Mutation: H514A-H515A
• GenBank ID: NM_001319652
• Entrez Gene: OSBPL8 (a.k.a. MST120, MSTP120, ORP8, OSBP10)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: ApaI (not destroyed)
• 5′ sequencing primer: GTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: CAGCCATCTCTTAGTCCAGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Francesca Giordano

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Original plasmid was generated in the laboratory of co-author Dr. Francesca Giordano, INSERM Paris-Saclay (Ref: Galmes et al. 2016 EMBO Rep. 2016 Jun; 17(6): 800–810. doi: 10.15252/embr.201541108). It was cloned into BglII and ApaI sites in the pEGFP-C1 vector (Clontech) from cDNA. The plasmid here was generated by site directed mutagenesis using the pEGFP-ORP8 construct as a template.