pCMV enAsCas12f-YHAM-sgRNA_v7
(Plasmid
#208356)
-
PurposeExpression of enAsCas12f-YHAM and sgRNA_v7 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208356 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV-AsCas12f1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameenAsCas12f-YHAM
-
Alt nameCas12U3
-
SpeciesSynthetic
-
MutationF48Y/S188H/V232A/E316M
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GCGATGCAATTTCCTCATTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV enAsCas12f-YHAM-sgRNA_v7 was a gift from Atsushi Hoshino (Addgene plasmid # 208356 ; http://n2t.net/addgene:208356 ; RRID:Addgene_208356) -
For your References section:
An AsCas12f-based compact genome-editing tool derived by deep mutational scanning and structural analysis. Hino T, Omura SN, Nakagawa R, Togashi T, Takeda SN, Hiramoto T, Tasaka S, Hirano H, Tokuyama T, Uosaki H, Ishiguro S, Kagieva M, Yamano H, Ozaki Y, Motooka D, Mori H, Kirita Y, Kise Y, Itoh Y, Matoba S, Aburatani H, Yachie N, Karvelis T, Siksnys V, Ohmori T, Hoshino A, Nureki O. Cell. 2023 Sep 22:S0092-8674(23)00963-7. doi: 10.1016/j.cell.2023.08.031. 10.1016/j.cell.2023.08.031 PubMed 37776859