Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Fus-BcLOV-mCh
(Plasmid #208277)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208277 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    NA
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Fus-BcLOV-mCh
  • Species
    Botrytis cinerea
  • Promoter pCMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGCACCAAAATCAACGGGACTTTCC
  • 3′ sequencing primer CCCAGCATGCCTGCTATTGTCTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Fus-BcLOV-mCh was a gift from Lukasz Bugaj (Addgene plasmid # 208277 ; http://n2t.net/addgene:208277 ; RRID:Addgene_208277)
  • For your References section:

    Optogenetic clustering and membrane translocation of the BcLOV4 photoreceptor. Pal AA, Benman W, Mumford TR, Huang Z, Chow BY, Bugaj LJ. Proc Natl Acad Sci U S A. 2023 Aug 8;120(32):e2221615120. doi: 10.1073/pnas.2221615120. Epub 2023 Aug 1. 10.1073/pnas.2221615120 PubMed 37527339