Fus-BcLOV-mCh
(Plasmid
#208277)
-
PurposeExpresses Fus-BcLOV fusion for optogenetic membrane recruitment. Includes an mCherry tag.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208277 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneNA
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFus-BcLOV-mCh
-
SpeciesBotrytis cinerea
- Promoter pCMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCACCAAAATCAACGGGACTTTCC
- 3′ sequencing primer CCCAGCATGCCTGCTATTGTCTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Fus-BcLOV-mCh was a gift from Lukasz Bugaj (Addgene plasmid # 208277 ; http://n2t.net/addgene:208277 ; RRID:Addgene_208277) -
For your References section:
Optogenetic clustering and membrane translocation of the BcLOV4 photoreceptor. Pal AA, Benman W, Mumford TR, Huang Z, Chow BY, Bugaj LJ. Proc Natl Acad Sci U S A. 2023 Aug 8;120(32):e2221615120. doi: 10.1073/pnas.2221615120. Epub 2023 Aug 1. 10.1073/pnas.2221615120 PubMed 37527339