pGL3-NBRE3
(Plasmid #208254)

• Purpose: pGL3 promoter luciferase reporter vector containing 3 copies of the NBRE DNA response element (5′-GAGTTTTAAAAGGTCATGCTCAATT TGTC-3′) used for luciferase reporter assays in mammalian cells
• Depositing Lab: Douglas Kojetin
• Publication: Munoz-Tello et al J Med Chem. 2020 Dec 24;63(24):15639-15654. doi: 10.1021/acs.jmedchem.0c00894. Epub 2020 Dec 8.

Backbone

• Vector backbone: pGL3-promoter
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 5010
• Total vector size (bp): 5090
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 3X NBRE-LUC
• Alt name: NGFI-B (Nerve Growth Factor-Induced Gene-B) Response
• Species: H. sapiens (human)
• Promoter: SV40 early promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (destroyed during cloning)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: CTAGCAAAATAGGCTGTCCC

Resource Information

• Supplemental Documents:
  • pGL3-NBRE3-LUC-RVPrimer3.gb
• A portion of this plasmid was derived from a plasmid made by: The plasmids were cloned in the Kojetin lab.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry