Addgene: pLenti-sgAMPKa1-Cas9-GFP Skip to main content
Addgene

pLenti-sgAMPKa1-Cas9-GFP
(Plasmid #208049)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208049 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti-Cas9-GFP
  • Backbone size w/o insert (bp) 13570
  • Total vector size (bp) 12000
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgPRKAA1
  • Alt name
    Protein Kinase AMP-Activated Catalytic Subunit Alpha 1
  • Alt name
    AMPKa1
  • gRNA/shRNA sequence
    GAAGATCGGCCACTACATTC
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_006251.6
  • Entrez Gene
    PRKAA1 (a.k.a. AMPK, AMPK alpha 1, AMPKa1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer gactatcatatgcttaccgt
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Jose Miguel Orozco, Ph.D

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2022.12.22.521608 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-sgAMPKa1-Cas9-GFP was a gift from Naama Kanarek (Addgene plasmid # 208049 ; http://n2t.net/addgene:208049 ; RRID:Addgene_208049)
  • For your References section:

    Folate depletion induces erythroid differentiation through perturbation of de novo purine synthesis. Maynard AG, Pohl NK, Mueller AP, Petrova B, Wong AYL, Wang P, Culhane AJ, Brook JR, Hirsch LM, Hoang N, Kirkland O, Braun T, Ducamp S, Fleming MD, Li H, Kanarek N. Sci Adv. 2024 Feb 2;10(5):eadj9479. doi: 10.1126/sciadv.adj9479. Epub 2024 Jan 31. 10.1126/sciadv.adj9479 PubMed 38295180