pLenti-sgAMPKa1-Cas9-GFP
(Plasmid
#208049)
-
PurposeLentiviral vector expressing Cas9 and an sgRNA targeting AMPKa1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208049 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti-Cas9-GFP
- Backbone size w/o insert (bp) 13570
- Total vector size (bp) 12000
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgPRKAA1
-
Alt nameProtein Kinase AMP-Activated Catalytic Subunit Alpha 1
-
Alt nameAMPKa1
-
gRNA/shRNA sequenceGAAGATCGGCCACTACATTC
-
SpeciesH. sapiens (human)
-
GenBank IDNM_006251.6
-
Entrez GenePRKAA1 (a.k.a. AMPK, AMPK alpha 1, AMPKa1)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer gactatcatatgcttaccgt
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byJose Miguel Orozco, Ph.D
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.12.22.521608 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-sgAMPKa1-Cas9-GFP was a gift from Naama Kanarek (Addgene plasmid # 208049 ; http://n2t.net/addgene:208049 ; RRID:Addgene_208049) -
For your References section:
Folate depletion induces erythroid differentiation through perturbation of de novo purine synthesis. Maynard AG, Pohl NK, Mueller AP, Petrova B, Wong AYL, Wang P, Culhane AJ, Brook JR, Hirsch LM, Hoang N, Kirkland O, Braun T, Ducamp S, Fleming MD, Li H, Kanarek N. Sci Adv. 2024 Feb 2;10(5):eadj9479. doi: 10.1126/sciadv.adj9479. Epub 2024 Jan 31. 10.1126/sciadv.adj9479 PubMed 38295180