pSEVA43-GG
(Plasmid
#208014)
-
Purposefor cloning homology arms, with GFP as counter selection marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208014 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSEVA231
-
Backbone manufacturerSEVA collection
- Backbone size w/o insert (bp) 3182
- Total vector size (bp) 4054
Growth in Bacteria
-
Bacterial Resistance(s)Streptomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemsfGFP
-
Insert Size (bp)717
- Promoter 14G
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer agcggataacaatttcacacagga
- 3′ sequencing primer cgccagggttttcccagtcacgac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.06.29.547033 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSEVA43-GG was a gift from Pablo Ivan Nikel (Addgene plasmid # 208014 ; http://n2t.net/addgene:208014 ; RRID:Addgene_208014) -
For your References section:
A SEVA-based, CRISPR-Cas3-assisted genome engineering approach for Pseudomonas with efficient vector curing. Lammens E-M, Volke DC, Schroven K, Voet M, Kerremans A, Lavigne R, Hendrix H. Microbiol Spectr. 2023 Nov 17:e0270723. doi: 10.1128/spectrum.02707-23. 10.1128/spectrum.02707-23 PubMed 37975669