pAf-CRISPR-phoA
(Plasmid
#207991)
-
PurposeCRISPR vector used with pAf-CRISPR-ctfR1 (#207992) to delete both aflatoxin and cyclopiazonic acid gene clusters of Aspergillus flavus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207991 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepPTRII
-
Backbone manufacturerTaKaRa
- Backbone size w/o insert (bp) 10031
- Total vector size (bp) 13733
-
Modifications to backboneRemoval of non-functional sequence of AMA1 in pPTRII, expression of cas9 using Aspergillus nidulans gpdA promoter and trpC terminator, expression of sgRNA using Aspergillus flavus U6 promoter and terminator
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namephoA
-
gRNA/shRNA sequenceGTCATCCTTAGACGACACTC
-
SpeciesAspergillus flavus
- Promoter Aspergillus flavus U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer ATACTGCAGTTCTCTTTAGAATTCAACTGTGGGT
- 3′ sequencing primer TATGGTACCACATATTTAAAAAAAGTCTCCTGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAf-CRISPR-phoA was a gift from Perng-Kuang Chang (Addgene plasmid # 207991 ; http://n2t.net/addgene:207991 ; RRID:Addgene_207991) -
For your References section:
Creating large chromosomal segment deletions in Aspergillus flavus by a dual CRISPR/Cas9 system: Deletion of gene clusters for production of aflatoxin, cyclopiazonic acid, and ustiloxin B. Chang PK. Fungal Genet Biol. 2023 Dec 27;170:103863. doi: 10.1016/j.fgb.2023.103863. 10.1016/j.fgb.2023.103863 PubMed 38154756