Skip to main content
Addgene

pLenti CMV TRE3G Puro FLAG-DD-ER-mCherry-TRF1-FokI D450A
(Plasmid #207953)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207953 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLenti-CMV-TRE3G
  • Backbone manufacturer
    takara
  • Total vector size (bp) 11843
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TRF1
  • Species
    H. sapiens (human)
  • Entrez Gene
    TERF1 (a.k.a. PIN2, TRBF1, TRF, TRF1, hTRF1-AS, t-TRF1)
  • Promoter TRE3G
  • Tags / Fusion Proteins
    • Flag, DD, ER, mCherry (N terminal on insert)
    • FokI (D450A) (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GTTTGTACAAAAAAGCAGGC
  • 3′ sequencing primer CTTTCACAAATTTTGTAATC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti CMV TRE3G Puro FLAG-DD-ER-mCherry-TRF1-FokI D450A was a gift from Roger Greenberg (Addgene plasmid # 207953 ; http://n2t.net/addgene:207953 ; RRID:Addgene_207953)

  • For your References section:

    Break-induced telomere synthesis underlies alternative telomere maintenance. Dilley RL, Verma P, Cho NW, Winters HD, Wondisford AR, Greenberg RA. Nature. 2016 Nov 3;539(7627):54-58. doi: 10.1038/nature20099. Epub 2016 Oct 19. 10.1038/nature20099 PubMed 27760120
Related items:
Commonly requested with: