miR-206-1/miR-133b promoter GFP
(Plasmid #20793)

• Depositing Lab: David Bartel
• Publication: Shkumatava et al Genes Dev. 2009 Feb 15. 23(4):466-81.

Backbone

• Vector backbone: pBSII SK+ modified to introduce GFP and more cloning sites
• Backbone manufacturer: Bartel Lab
• Vector type: zebrafish expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mir-206-1/mir-133b
• Alt name: miR-206
• Alt name: miR-133
• Species: D. rerio (zebrafish)
• Insert Size (bp): 4500
• Entrez Gene: mir206-1 (a.k.a. dre-mir-206-1)
• Tag / Fusion Protein:
  • GFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: ApaI (unknown if destroyed)
• 3′ cloning site: SmaI (destroyed during cloning)
• 5′ sequencing primer: CTGCCCCATTTAGACTCTTTCTTGACG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For polycistronic mir-206-1/mir-133b, we were not able to identify the transcriptional start precisely by 5′-RACE due to the repetitive sequence in this region. Analyses of EST clones (BM259633, CF999541, CF348604, DR729161) mapped the approximate start of the mir-206-1/mir-133b primary transcript to 1.4 kb from the mir-206 hairpin. A 4.5-kb upstream fragment that includes ∼0.9 kb of the primary transcript was amplified from genomic DNA using primers 3 and 4 (5'-CTGCCCCATTTAGACTCTTTCTTGACG-3' and 5'-CCAGAAGAACCCAGACGAAACCCAC-3'). The promoter fragment was fused to a GFP reporter gene. The miRNA promoter fusion was flanked by I-SceI meganuclease recognition sites to increase the efficiency of transgenensis.

Please note that Addgene's sequencing results show some differences from the published sequence. The depositing lab is aware of the differences.