miR-124-5 promoter GFP
(Plasmid #20792)

• Depositing Lab: David Bartel
• Publication: Shkumatava et al Genes Dev. 2009 Feb 15. 23(4):466-81.

Backbone

• Vector backbone: pBSII SK+ modified to introduce GFP and more cloning sites
• Backbone manufacturer: Bartel Lab
• Vector type: zebrafish expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mir-124
• Alt name: miR124
• Species: D. rerio (zebrafish)
• Insert Size (bp): 5600
• Entrez Gene: mir124-5 (a.k.a. dre-mir-124-5)
• Tag / Fusion Protein:
  • GFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SmaI (destroyed during cloning)
• 3′ cloning site: SalI (unknown if destroyed)
• 5′ sequencing primer: TGCTTTGAGGCACGGTTATGGTCCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

5′-RACE (GenRacer kit, Invitrogen) identified a transcriptional start of the mir-124-5 primary transcript, which is located 1.1 kb from the mir-124-5 hairpin. A 5.6-kb fragment upstream of the mir-124-5 transcriptional start was amplified from genomic DNA using primers 1 and 2 (5'-TGCTTTGAGGCACGGTTATGGTCCC-3' and 5'-CTCGGGCAGCGGCTTTTTGGTCCTG-3'). The promoter fragment was fused to a GFP reporter gene. The miRNA promoter fusion was flanked by I-SceI meganuclease recognition sites to increase the efficiency of transgenensis.