pDual
(Plasmid #207883)

• Purpose: Expresses thermosensitive variants of the homing endonucleases I-OnuI and I-GpeMI, each in a different open reading frame. Both were made thermosensitive by a fusion with the L212P VMA1 intein.
• Depositing Lab: David Edgell
• Publication: Foo et al Nucleic Acids Res. 2024 Feb 28;52(4):2066-2077. doi: 10.1093/nar/gkad1247.

Backbone

• Vector backbone: pACYC177
• Backbone manufacturer: New England Biolabs
• Backbone size w/o insert (bp): 3002
• Total vector size (bp): 7577
• Modifications to backbone: Inserted the I-OnuI TSM and I-GpeMI TSM, each under separate open reading frames.
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Thermosensitive fusion of I-OnuI and the L212P VMA1 intein.
• Alt name: I-OnuI TSM
• Species: S. cerevisiae (budding yeast), Synthetic; O. novo-ulmi
• Insert Size (bp): 2280
• Mutation: Leucine 212 changed to proline, leucine 434 in the full-length fusion. Alanine 640 changed to valine.

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTCAAATGGACGAAGCAGG

Gene/Insert 2

• Gene/Insert name: Thermosensitive fusion of I-GpeMI and the L212P VMA1 intein.
• Alt name: I-GpeMI TSM
• Species: S. cerevisiae (budding yeast); G. penicillata
• Insert Size (bp): 2295
• Mutation: Leucine 212 changed to proline, leucine 438 in the full-length fusion.

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTTTTGCTGAGTTGAAGGATCAG

Resource Information

• Supplemental Documents:
  • pdual.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The Edgell Lab uses EPI300 E. coli for transformation, but DH5alpha will also be fine.