Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRset-ARSeNL
(Plasmid #207872)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207872 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRset
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2752
  • Total vector size (bp) 4465
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ARSeNL
  • Alt name
    mScarlet-BsEpsilon-NanonLuc
  • Species
    Synthetic
  • Insert Size (bp)
    1713
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRset-ARSeNL was a gift from Mathew Tantama (Addgene plasmid # 207872 ; http://n2t.net/addgene:207872 ; RRID:Addgene_207872)
  • For your References section:

    Ratiometric BRET Measurements of ATP with a Genetically-Encoded Luminescent Sensor. Min SH, French AR, Trull KJ, Tat K, Varney SA, Tantama M. Sensors (Basel). 2019 Aug 10;19(16). pii: s19163502. doi: 10.3390/s19163502. 10.3390/s19163502 PubMed 31405152