pRset-OppA
(Plasmid
#207869)
-
PurposeBacterial expression of poly-his-tagged L. lactic OppA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207869 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRset
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2761
- Total vector size (bp) 4666
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOppA
-
SpeciesL. lactis
-
Insert Size (bp)1905
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRset-OppA was a gift from Mathew Tantama (Addgene plasmid # 207869 ; http://n2t.net/addgene:207869 ; RRID:Addgene_207869) -
For your References section:
pH- and Temperature-Dependent Peptide Binding to the Lactococcus lactis Oligopeptide-Binding Protein A Measured with a Fluorescence Anisotropy Assay. Norcross S, Sunderraj A, Tantama M. ACS Omega. 2019 Feb 28;4(2):2812-2822. doi: 10.1021/acsomega.8b02427. Epub 2019 Feb 6. 10.1021/acsomega.8b02427 PubMed 30842982