GW1-mCherryEA
(Plasmid
#207867)
-
PurposeMammalian expression (cytosol) of the mCherry(I158E/Q160A) mutant as a red fluorescent pH sensor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207867 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneGW1
- Backbone size w/o insert (bp) 5274
- Total vector size (bp) 5984
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCherryEA
-
Alt namemCherry(I158E/Q160A)
-
SpeciesSynthetic
-
Insert Size (bp)711
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGAATCGGAGTGAGTGC
- 3′ sequencing primer CAAATGTGGTATGGCTGATT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GW1-mCherryEA was a gift from Mathew Tantama (Addgene plasmid # 207867 ; http://n2t.net/addgene:207867 ; RRID:Addgene_207867) -
For your References section:
Imaging pH Dynamics Simultaneously in Two Cellular Compartments Using a Ratiometric pH-Sensitive Mutant of mCherry. Rajendran M, Claywell B, Haynes EP, Scales U, Henning CK, Tantama M. ACS Omega. 2018 Aug 31;3(8):9476-9486. doi: 10.1021/acsomega.8b00655. Epub 2018 Aug 20. 10.1021/acsomega.8b00655 PubMed 30197999