RGB-S reporter
(Plasmid #207841)

• Purpose: A three-colour stress biosensor for real time analysis of physiological stress, genotoxicity, and cytotoxicity of Escherichia coli
• Depositing Lab: Christof Niemeyer
• Publication: Zoheir et al NPJ Biofilms Microbiomes. 2023 Aug 21;9(1):57. doi: 10.1038/s41522-023-00424-1.

Backbone

• Vector backbone: pMK-RQ
• Backbone manufacturer: GeneArt® Gene Synthesis, ThermoFisher Scientific and IDT Inc.
• Backbone size w/o insert (bp): 4531
• Total vector size (bp): 5409
• Modifications to backbone: PsulA::GFPmut3b::terminator_1 and PosmY::mRFP1::terminator_2 were integrated into pMK-RQ by GeneArt, then integration of terminator_3::PgrpE::mTagBFP2::terminator_4
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: RpoH sensing construct
• Alt name: PgrpE::mTagBFP2
• Species: Synthetic
• Insert Size (bp): 717
• GenBank ID: UYR58244.1
• Promoter: grpE

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCAGTGAGCGCGACGTAATA
• 3′ sequencing primer: CGGCCACTCAACCCTATCTC

Gene/Insert 2

• Gene/Insert name: SOS sensing construct
• Alt name: PsulA::GFPmut3b
• Species: Synthetic
• Insert Size (bp): 720
• GenBank ID: AAB18957.1
• Promoter: PsulA

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: synthesized on backbone
• 3′ sequencing primer: -

Gene/Insert 3

• Gene/Insert name: RpoS sensing construct
• Alt name: PosmY::mRFP1
• Insert Size (bp): 681
• GenBank ID: CAH64892
• Promoter: PosmY

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: synthesized on backbone
• 3′ sequencing primer: -

Resource Information

• Supplemental Documents:
  • RGB-S reporter.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The submitted plasmid version has additional 111 bp (1181-1291 bp) in the plasmid backbone compared to the version in the publication. The deposited plasmid has been tested and experimentally validated entailing no impact on the biosensor function.