Skip to main content
Addgene

pTRE-BI-hGRAD
(Plasmid #207837)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207837 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    VB190904-1039fwc
  • Backbone manufacturer
    VectorBuilder
  • Backbone size w/o insert (bp) 6768
  • Total vector size (bp) 8431
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Although the plasmid is expressed from a "high-copy" ORI, the amounts of plasmid recovered from conventional plasmid preparations are relatively low (possibly due to the size and/or complexity of the plasmid).
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mCherry
  • Insert Size (bp)
    711
  • Promoter TRE3G BI promoter

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site SpeI (unknown if destroyed)
  • 5′ sequencing primer AACTCGAGTATGTCGAGG
  • 3′ sequencing primer TTTTGGCAGAGGGAAAAAGA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    hFBXW11
  • Alt name
    F-box/WD repeat-containing protein 11 isoform B
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    645
  • Mutation
    215 amino acids of the full length protein
  • Entrez Gene
    FBXW11 (a.k.a. BTRC2, BTRCP2, FBW1B, FBXW1B, Fbw11, Hos, NEDJED)
  • Promoter TRE3G BI promoter

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCTACCCTCGTAAACCGC
  • 3′ sequencing primer AAAGGACAGTGGGAGTGG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    VHH-GFP4
  • Alt name
    GFP Nanobody
  • Species
    Synthetic
  • Insert Size (bp)
    342
  • Promoter TRE3G BI promoter

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCTACCCTCGTAAACCGC
  • 3′ sequencing primer AAAGGACAGTGGGAGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRE-BI-hGRAD was a gift from Michaela Mueller-McNicoll (Addgene plasmid # 207837 ; http://n2t.net/addgene:207837 ; RRID:Addgene_207837)
  • For your References section:

    hGRAD: A versatile "one-fits-all" system to acutely deplete RNA binding proteins from condensates. Arnold B, Riegger RJ, Okuda EK, Sliskovic I, Keller M, Bakisoglu C, McNicoll F, Zarnack K, Muller-McNicoll M. J Cell Biol. 2024 Feb 5;223(2):e202304030. doi: 10.1083/jcb.202304030. Epub 2023 Dec 18. 10.1083/jcb.202304030 PubMed 38108808