Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti CMV TRE3G Puro FLAG-DD-ER-mCherry-TRF1-FokI WT
(Plasmid #207832)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207832 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti-CMV-TRE3G
  • Backbone manufacturer
    takara
  • Total vector size (bp) 11843
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TRF1
  • Species
    H. sapiens (human)
  • Entrez Gene
    TERF1 (a.k.a. PIN2, TRBF1, TRF, TRF1, hTRF1-AS, t-TRF1)
  • Promoter TRE3G
  • Tags / Fusion Proteins
    • Flag, DD, ER, mCherry (N terminal on insert)
    • FokI (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GTTTGTACAAAAAAGCAGGC
  • 3′ sequencing primer CTTTCACAAATTTTGTAATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti CMV TRE3G Puro FLAG-DD-ER-mCherry-TRF1-FokI WT was a gift from Roger Greenberg (Addgene plasmid # 207832 ; http://n2t.net/addgene:207832 ; RRID:Addgene_207832)
  • For your References section:

    Break-induced telomere synthesis underlies alternative telomere maintenance. Dilley RL, Verma P, Cho NW, Winters HD, Wondisford AR, Greenberg RA. Nature. 2016 Nov 3;539(7627):54-58. doi: 10.1038/nature20099. Epub 2016 Oct 19. 10.1038/nature20099 PubMed 27760120