pLenti-Cas9-NS-B
(Plasmid
#207824)
-
PurposeDual expression of Cas9 and non-specific sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207824 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti-Cas9
-
Vector typeLentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenon-specific sgRNA
-
gRNA/shRNA sequenceGTCATCAAGGAGCATTCCGT
-
SpeciesH. sapiens (human)
- Promoter EF-1a; U6
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-Cas9-NS-B was a gift from Ben Major (Addgene plasmid # 207824 ; http://n2t.net/addgene:207824 ; RRID:Addgene_207824) -
For your References section:
Proximity proteomic analysis of the NRF family reveals the Parkinson's disease protein ZNF746/PARIS as a co-complexed repressor of NRF2. LaPak KM, Saeidi S, Bok I, Wamsley NT, Plutzer IB, Bhatt DP, Luo J, Ashrafi G, Ben Major M. Sci Signal. 2023 Dec 12;16(815):eadi9018. doi: 10.1126/scisignal.adi9018. Epub 2023 Dec 12. 10.1126/scisignal.adi9018 PubMed 38085818