qTAG-N-Solo-sTagRFP-TUBA1B
(Plasmid
#207765)
-
PurposeDonor template for sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207765 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepUC19
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2686
-
Vector typeMammalian Expression, CRISPR ; Donor Template
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTUBA1B Homology Arms flanking a sTagRFP Tag
-
Alt nameTUBA1B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1896
-
Entrez GeneTUBA1B (a.k.a. K-ALPHA-1)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTGCAAGGCGATTAAGTTGGGTAAC
- 3′ sequencing primer GGCTCGTATGTTGTGTGGAATTGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B https://www.addgene.org/207763 .
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
qTAG-N-Solo-sTagRFP-TUBA1B was a gift from Laurence Pelletier (Addgene plasmid # 207765 ; http://n2t.net/addgene:207765 ; RRID:Addgene_207765) -
For your References section:
qTAG: An adaptable CRISPR-based endogenous tagging protocol using optimized repair cassettes. Philip R, Sharma A, Matellan L, Erpf AC, Hsu W, Tkach JM, Wyatt HDM, Pelletier L. bioRxiv 10.1101/2023.11.01.565029