pX330-PITCh-H2BC11
(Plasmid
#207755)
-
PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of H2BC11 for knock-in.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207755 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepX330-BbsI-PITCh
-
Backbone manufacturerAddgene #127875
- Backbone size w/o insert (bp) 8947
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesgRNA Targeting C-terminus of H2BC11
-
Alt nameH2BC11
-
gRNA/shRNA sequenceACTCACTGTTTACTTAGCGC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GeneH2BC11 (a.k.a. H2B/r, H2BFR, H2BJ, HIST1H2BJ)
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCCTTTTTACGGTTCCTGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-PITCh-H2BC11 was a gift from Laurence Pelletier (Addgene plasmid # 207755 ; http://n2t.net/addgene:207755 ; RRID:Addgene_207755) -
For your References section:
qTAG: An adaptable CRISPR-based endogenous tagging protocol using optimized repair cassettes. Philip R, Sharma A, Matellan L, Erpf AC, Hsu W, Tkach JM, Wyatt HDM, Pelletier L. bioRxiv 10.1101/2023.11.01.565029
