pMF2-yhaO
(Plasmid
#207654)
-
PurposeOverexpression of L-cysteine importer in E. coli MG1655
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207654 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTR48
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameyhaO
-
Alt namecyuP
-
Alt namedlsT
-
SpeciesEscherichia coli K-12 MG1655
- Promoter araBp
-
Tag
/ Fusion Protein
- 6xHis (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggaccaaagccatgacaaaaacgcg
- 3′ sequencing primer gcccagtatcagcccgtcatacttga (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMF2-yhaO was a gift from Benjamin Woolston (Addgene plasmid # 207654 ; http://n2t.net/addgene:207654 ; RRID:Addgene_207654) -
For your References section:
Engineered bacteria titrate hydrogen sulfide and induce concentration-dependent effects on the host in a gut microphysiological system. Hayes JA, Lunger AW, Sharma AS, Fernez MT, Carrier RL, Koppes AN, Koppes R, Woolston BM. Cell Rep. 2023 Dec 26;42(12):113481. doi: 10.1016/j.celrep.2023.113481. Epub 2023 Nov 18. 10.1016/j.celrep.2023.113481 PubMed 37980564